rpsJ

Information for rpsJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3449934-3450563 - CDS rplC EG10866 50S ribosomal subunit protein L3 3450596-3450907 - CDS rpsJ EG10909 30S ribosomal subunit protein S10 3451145-3451564 - CDS pinO EG11263 calcium-binding protein required for initiation of chromosome replication

Reported regulatory sites for rpsJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.046 3451043-3451059 R acagc AGGTTCAATCTGAACCT cagtt - 0 - 3.044 3450966-3450988 R gtaag AACGGTTACACTCTCCCATCAAT cgtaa - 0 - 3.044 3450940-3450962 R atcgt AATGGGTCTGAGGAGTAATCATT ttcgt - 0 - 2.417 3450997-3451013 R acaat GCTCCCAATCGGGGAGC tacgt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back