rpsL

Information for rpsL, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3471179-3471718 - CDS rpsG EG10906 30S ribosomal subunit protein S7; initiates assembly 3471815-3472189 - CDS rpsL EG10911 30S ribosomal subunit protein S12 3472315-3472602 - CDS yheL EG12896 orf; hypothetical protein

Reported regulatory sites for rpsL: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.663 3472190-3472206 R agcta AAACCAGGAGCTATTTA atggc - 0 - 4.489 3472287-3472302 R atcgt TGTATATTTCTTGACA ccttt - 0 - 3.614 3472248-3472268 R gccct AAAATTCGGCGTCCTCATATT gtgtg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back