rpsM

Information for rpsM, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3439346-3439735 - CDS rpsK EG10910 30S ribosomal subunit protein S11 3439752-3440108 - CDS rpsM EG10912 30S ribosomal subunit protein S13 3440255-3440371 - CDS rpmJ EG11232 50S ribosomal subunit protein L36

Reported regulatory sites for rpsM: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 9.449 3440142-3440164 R gagta TCCTGAAAACGGGCTTTTCAGCA tggaa - 0 - 6.923 3440324-3440346 R caaga AATTATGCCGTAACTGCAAAATC gttaa - 0 - 6.543 3440352-3440371 R taaaa ATGAAAGTTCGTGCTTCCGT caaga - 0 - 5.272 3440253-3440272 R agcat AAACAGCGCCAAGGCTGATT ttttc - 0 - 4.886 3440230-3440250 R atttt TTCGCATATTTTTCTTGCAAA gttgg - 0 - 4.886 3440198-3440218 R ttgag CTGGCTAGATTAGCCAGCCAA tcttt - 0 - 4.386 3440564-3440587 R tacct TTATCTGCCTGATCCCGGAGTTCA tgcgt - 0 - 4.386 3440486-3440509 R tatcg TTGTTGTCGTGATTATGGACTTTA tggct - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back