sanA

Information for sanA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2229864-2230748 + CDS cdd EG10137 cytidine/deoxycytidine deaminase 2230898-2231617 + CDS sanA EG12025 vancomycin sensitivity 2231620-2231859 + CDS b2145 EG14073 orf; hypothetical protein

Reported regulatory sites for sanA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.321 2230850-2230866 aacca GCGGGTAAAGTAGCCTG atgga - 0 - 2.127 2230816-2230832 attcc CGGCAAACAGTTTGCCG tttct - 0 - 0.471 2230765-2230786 gatgc GGCGTGAACGCCTTGTCCGGCT tgcca - 0 REP155 (22)

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back