sapA

Information for sapA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1352529-1353494 - CDS sapB EG20255 homolog of Salmonella peptide transport permease protein 1353491-1355134 - CDS sapA EG20254 homolog of Salmonella peptide transport periplasmic protein 1355447-1355692 - CDS ymjA EG14295 orf; hypothetical protein

Reported regulatory sites for sapA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.252 1355172-1355188 R atggc AAATGTCATTAAATATT agtaa - 0 - 0.356 1355142-1355163 R aagat AGCCTCTTTACATAAAATCCCT taata - 0 - 0.209 1355281-1355302 R ctgtg AGTTATAGTTATAGAGAAATCA cgggt - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back