sbcD

Information for sbcD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 411831-414977 - CDS sbcC EG10927 ATP-dependent dsDNA exonuclease 414974-416176 - CDS sbcD EG11094 ATP-dependent dsDNA exonuclease 416366-417055 + CDS phoB EG10728 positive response regulator for pho regulon; sensor is PhoR (or CreC)

Reported regulatory sites for sbcD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.260 416298-416321 R gcgac GTCATTATGCGTCAGATTTATGAC agatt phoB 20 - 2.175 416282-416297 R atgac AGATTTATGAAAAGCT cgtcg phoB 13 - 0.630 416200-416223 R gcaca TCTGTTTGGGTATAATCGCGCCCA tgctt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back