sbmA

Information for sbmA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 394354-395511 - CDS yaiH EG12867 putative enzyme 395863-397083 + CDS sbmA EG10928 sensitivity to microcin B17; possibly envelop protein 397096-398190 + CDS yaiW EG13608 orf; hypothetical protein

Reported regulatory sites for sbmA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.225 395546-395562 actga GCGTATTTATACTACTC attga - 0 - 1.852 395834-395857 ttgtt AAAACGATAAGAAGTTAGCAGGAG tgcat - 0 - 1.707 395709-395728 tttgt GAAATCCGTCGAAACAATTC ttatg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back