sbmC

Information for sbmC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2077555-2078613 - CDS yeeA EG11891 orf; hypothetical protein 2078811-2079284 - CDS sbmC EG11892 SbmC protein 2079403-2080575 - CDS dacD EG11893 penicillin binding protein 6b

Reported regulatory sites for sbmC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.358 2079298-2079319 R caact ATACTGTATATAAAAACAGTAT caatg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.642 2079356-2079377 R ggcag GAGTGCGAGTCTGCTCGCATAA tcaac - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back