sbp

Information for sbp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4105132-4106094 + CDS pfkA EG10699 6-phosphofructokinase I 4106414-4107403 + CDS sbp EG10929 periplasmic sulfate-binding protein 4107510-4108265 + CDS cdh EG10138 CDP-diacylglycerol phosphotidylhydrolase

Reported regulatory sites for sbp: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.737 4106327-4106347 caagt TATAGCCAATCTTTTTTTATT cttta - 0 - 3.187 4106152-4106174 aaatg CCTGATGCGCTTCGCTTATCAGG cctac - 0 REPv302a (23) 3.187 4106368-4106390 aacct TCTGGCACGCTTTGCTCATCACA acaca - 0 - 1.590 4106216-4106233 ttttg TAGGCCGGATAAGGCGTT cgcgc - 0 REP302b (18) 1.590 4106234-4106251 gcgtt CGCGCCGCATCCGGCATG gacaa - 0 REP302b (15)

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back