sdaA

Information for sdaA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1894194-1894772 + CDS yeaB EG12693 orf; hypothetical protein 1894956-1896320 + CDS sdaA EG10930 L-serine deaminase 1896421-1898049 + CDS b1815 EG13516 orf; hypothetical protein

Reported regulatory sites for sdaA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.944 1894852-1894872 ttagt TTAATTCATGTGAATAGTTAA gccag - 0 - 2.487 1894825-1894848 caata TTAGTTAAATCGCGGTTTTTGATT agttt - 0 - 2.487 1894893-1894916 ccctc TTACACTATGCGCTGTTATTAGTT cgtta - 0 - 2.324 1894805-1894822 actac TTGAGACAATCATCGCAA tatta - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back