sdhC

Information for sdhC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 752408-753691 - CDS gltA EG10402 citrate synthase 754400-754789 + CDS sdhC EG10933 succinate dehydrogenase; cytochrome b556 754783-755130 + CDS sdhD EG10934 succinate dehydrogenase; hydrophobic subunit

Reported regulatory sites for sdhC: Genome coordinates Source Transcription factor Transcription factor annotation 754137-754168 PMID: 8892825 arcA negative response regulator of genes in aerobic pathways (sensors ArcB and CpxA) 754025-754087 PMID: 8892825 arcA negative response regulator of genes in aerobic pathways (sensors ArcB and CpxA)

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.330 754268-754289 cgcag TTATAGAAAGGACGCTGTCTGA cccgc - 0 - 2.874 754165-754187 acagc CTATACTGCCGCCAGGTCTCCGG aacac arcA 4 - 2.874 754290-754312 tctga CCCGCAAGCAGACCGGAGGAAGG aaatc - 0 - 2.842 754087-754108 gttgt TATCGTGACCTGGATCACTGTT cagga arcA 1 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back