sdiA

Information for sdiA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1993841-1994065 + CDS yecF EG12861 orf; hypothetical protein 1994133-1994855 - CDS sdiA EG10935 transcriptional regulator of ftsQAZ gene cluster 1995085-1995837 - CDS yecC EG12347 putative ATP-binding component of a transport system

Reported regulatory sites for sdiA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.804 1994919-1994942 R gaata ATATAAATTATATATAAATCTTAT ttatg - 0 - 3.804 1994879-1994902 R tttga ATTATCATTATAAATGATACTCAC tctca - 0 - 0.286 1995050-1995073 R aaaat CAGCCCCGACGATTCACCTGTCGG ggctg - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back