secA

Information for secA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 107630-108217 + CDS yacA EG11087 orf; hypothetical protein 108279-110984 + CDS secA EG10936 preprotein translocase; secretion protein 111044-111433 + CDS mutT EG10626 7;8-dihydro-8-oxoguanine-triphosphatase; prefers dGTP; causes AT-GC transversions

Reported regulatory sites for secA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.674 108219-108242 ctaac AACAATAAACCTTTACTTCATTTT attaa - 0 - 1.403 108250-108270 taact CCGCAACGCGGGGCGTTTGAG atttt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back