secG

Information for secG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3319713-3319799 - tRNA leuU EG30050 Leucine tRNA2 3319814-3320146 - CDS secG EG12095 protein export - membrane protein 3320374-3321711 - CDS mrsA EG11553 similar to phosphoglucomutases and phosphomannomutases

Reported regulatory sites for secG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.109 3320313-3320335 R gtcgc CTTTTTTCTCAGCGAACACATCG gtttt - 0 - 4.109 3320229-3320251 R tcatt CGCTTTGGTTAGTATTCACACCC gcttc - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.288 3320193-3320208 R attaa AAACTCCCGCTTTATT ggttg - 0 - 1.288 3320147-3320162 R tccgc AAGGAACAGGTTGATT atgta - 0 - 1.237 3320252-3320273 R gataa AATTGCCCTTGCGAAGGTCATT cgctt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back