selD

Information for selD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1843023-1844984 - CDS topB EG11014 DNA topoisomerase III 1844989-1846032 - CDS selD EG10943 selenophosphate synthase; H(2)Se added to acrylyl-tRNA 1846149-1846700 - CDS ydjA EG11134 orf; hypothetical protein

Reported regulatory sites for selD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.394 1846070-1846090 R tctca CTTATCACTTCACGGAATGAG ggtta - 0 - 1.490 1846044-1846065 R gggtt ACCATACCCGGATTGCATTGAC aggag - 0 - 1.237 1846110-1846132 R aaact GTCTGGATTGTGAGCAAAGGCGC aggaa - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back