seqA

Information for seqA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 711261-712025 - CDS ybfF EG11776 orf; hypothetical protein 712210-712755 + CDS seqA EG12197 negative modulator of initiation of replication 712781-714421 + CDS pgm EG12144 phosphoglucomutase

Reported regulatory sites for seqA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.985 712027-712043 tcatg GCAAAGTTCTTTTTTTC gcgtt - 0 - 2.985 712090-712106 gggct GCAACAAATAAGGTTTA ttccg - 0 - 2.301 712058-712079 ggtta GGGTATTATGTTGACCATTGTG ccaca - 0 - 2.301 712150-712171 ctgcc GGGATTTATTCATATACTCCTG gcgac - 0 - 1.418 712113-712136 tccga GTTTTTCTGCAAGCCAGGCTTGAC gctat - 0 - 1.418 712186-712209 attca GCTAAGACACTGCACTGGATTAAG atgaa - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back