serB

Information for serB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4621714-4622358 - CDS smp EG10951 orf; hypothetical protein 4622464-4623432 + CDS serB EG10945 3-phosphoserine phosphatase 4623481-4624863 + CDS sms EG11296 probable ATP-dependent protease

Reported regulatory sites for serB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.329 4622371-4622394 ccttt GAAAATTTGAGACTTAATGTTGCC agaag - 0 - 4.329 4622412-4622435 tacaa GGTAGCCTCATGCGTTATTTTCCC tgctt - 0 - 0.592 4622395-4622410 ttgcc AGAAGCAATGGATACA aggta - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back