serS

Information for serS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 937217-938560 + CDS ycaJ EG12690 putative polynucleotide enzyme 938651-939943 + CDS serS EG10947 serine tRNA synthetase; also charges selenocystein tRNA with serine 940269-942626 + CDS dmsA EG10232 anaerobic dimethyl sulfoxide reductase subunit A

Reported regulatory sites for serS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.802 938559-938581 ccgtt AATGTTATCGTTGCGGTAATGTT gttac - 0 - 1.705 938627-938649 ccatt TAATTCGATAAGCACAGGATAAG catgc - 0 - 0.301 938597-938615 ccctg TGGTCGCAGGCTGTGGCCA catct - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back