sfcA

Information for sfcA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1550852-1551892 - CDS adhP EG12622 alcohol dehydrogenase 1551996-1553720 - CDS sfcA EG10948 NAD-linked malate dehydrogenase (malic enzyme) 1553850-1553987 - CDS rpsV EG11508 30S ribosomal subunit protein S22

Reported regulatory sites for sfcA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.559 1553796-1553817 R ttaaa CACCATTGCCTGCGCAATGGTG ttttt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.004 1553814-1553836 R catca GTCCTCAATGACGATTAAACACC attgc - 0 - 0.614 1553766-1553786 R tgttt TTATCTGCTTTATACTTGAGG ccgac - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back