sfhB

Information for sfhB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2732323-2733054 - CDS yfiH EG12097 orf; hypothetical protein 2733051-2734031 - CDS sfhB EG12098 suppressor of ftsH mutation 2734166-2734903 + CDS b2595 EG14222 orf; hypothetical protein

Reported regulatory sites for sfhB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.332 2734141-2734164 R tcatg ACGTTTTGACTTTCCTCAAAATGT aatac - 0 - 4.712 2734077-2734100 R gacca GCTACAATAGCACACTATATTAAA cggca - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.368 2734121-2734137 R gtaat ACGGGAGATTCTCTGTT cctgc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back