sfmA

Information for sfmA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 556098-556964 - CDS folD EG10328 5;10-methylene-tetrahydrofolate dehydrogenase; 5;10-methylene-tetrahydrofolate cyclohydrolase 557402-557977 + CDS sfmA EG13881 putative fimbrial-like protein 558197-558889 + CDS sfmC EG13882 putative chaperone

Reported regulatory sites for sfmA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.438 557009-557025 tgcgc CTATTTTGTCAGAAGCG gggcg - 0 - 2.009 557314-557331 agagt GCATATTTTCAATTAAGA cattc - 0 - 0.203 557374-557396 tgtct TAAATAAAGTAATCGGTTATATA cggat - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back