sfmC

Information for sfmC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 557402-557977 + CDS sfmA EG13881 putative fimbrial-like protein 558197-558889 + CDS sfmC EG13882 putative chaperone 558920-561523 + CDS sfmD EG13883 putative outer membrane protein; export function

Reported regulatory sites for sfmC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.151 558162-558177 cctta TTTTTGCCGTCAGGAA tacac - 0 - 0.000 558135-558151 aaacc AAAGCAATCATTTCTTT atatt - 0 - - 0.000 557977-557998 gaata ATCAAAACCACGTTGTTTTGAA ttata - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back