sgaT

Information for sgaT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4416139-4417209 - CDS yjfR EG12492 orf; hypothetical protein 4417501-4418955 + CDS sgaT EG12493 orf; hypothetical protein 4418971-4419276 + CDS sgaB EG12494 orf; hypothetical protein

Reported regulatory sites for sgaT: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.076 4417261-4417282 attaa TCCTGACACTATTTTTTCAGGA aggca - 0 - 3.383 4417235-4417257 ttcga ATCAATATGTGATTGGTTTTGAT taatc - 0 - 3.383 4417457-4417479 attta ATCATAAATAATCTTGTTGTGAT tactt - 0 - 3.136 4417433-4417456 ggaat TATTTGCGGGTCGCGTCACATTTA atcat - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back