sgcC

Information for sgcC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4525679-4526485 - CDS sgcQ EG12555 putative nucleoside triphosphatase 4526498-4527811 - CDS sgcC EG12556 putative PTS system enzyme IIC component 4528098-4529249 - CDS sgcX EG12557 putative lyase/synthase

Reported regulatory sites for sgcC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.304 4528064-4528084 R cttgt GGCATGCGGTACCGGCATGTC gactt - 0 - 4.214 4527932-4527954 R acggt ATGGACCTTATTGTAACCTCCAT gcgaa - 0 - 3.560 4528045-4528060 R tcgac TTCAACCATGATTGCA cacaa - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back