sgcX

Information for sgcX, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4526498-4527811 - CDS sgcC EG12556 putative PTS system enzyme IIC component 4528098-4529249 - CDS sgcX EG12557 putative lyase/synthase 4530005-4530751 - CDS yjhP EG12558 putative methyltransferase

Reported regulatory sites for sgcX: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.546 4529254-4529272 R cagtc TGCGCCTATAAAACGCTCA acgag - 0 - 1.674 4529284-4529307 R gcgtt TTCACGTGAACGTTCTCACAATTA ttcga - 0 - 0.821 4529327-4529343 R ctcgg CTCACATAATTTTTTAT ttgtt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back