slp

Information for slp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3649812-3650828 - CDS trs5_11 - IS5 transposase 3651558-3652157 + CDS slp EG11890 outer membrane protein induced after carbon starvation 3652313-3652843 + CDS yhiF EG11889 orf; hypothetical protein

Reported regulatory sites for slp: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.000 3651145-3651168 aaaat TCAAACATGGGCAGAAATGTCTGA atatc - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back