slt

Information for slt, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4626424-4628091 - CDS yjjK EG12343 putative ATP-binding component of a transport system 4628275-4630239 + CDS slt EG10950 soluble lytic murein transglycosylase 4630329-4630655 + CDS trpR EG11029 regulator for trp operon and aroH; trp aporepressor

Reported regulatory sites for slt: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.529 4628133-4628152 ttttc AAAGGCGAAGTGTAGCCTTT ttccc - 0 - 3.529 4628193-4628212 cagta AAAGTAAAAAAGTGTCCGTA acgtg - 0 - 2.662 4628110-4628128 tctat GTTTATCGTGATAATGAGT tttca - 0 - 2.662 4628254-4628272 ctatt ACGCGGCATGACGCTGCAT tgatg - 0 - 1.978 4628233-4628253 caatg ACTGGTTAGCATAAATCTATT acgcg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back