slyB

Information for slyB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1716517-1717626 - CDS b1640 EG13942 orf; hypothetical protein 1717900-1718367 + CDS slyB EG13409 putative outer membrane protein 1718414-1718854 - CDS slyA EG13408 transcriptional regulator for cryptic hemolysin

Reported regulatory sites for slyB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.718 1717814-1717837 tagaa CATGTAACCATGGATTCACATATG ccata - 0 - 1.660 1717874-1717892 tggcg TTTCATGGTGAACAGGAGA ttttt - 0 - 1.552 1717629-1717649 catag TTCATCCTTTTTCAATCTGAC gtttg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back