slyX

Information for slyX, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3474244-3475056 - CDS fkpA EG12900 FKBP-type peptidyl-prolyl cis-trans isomerase (rotamase) 3475277-3475495 + CDS slyX EG11664 host factor for lysis of phiX174 infection 3475544-3476134 - CDS slyD EG11663 FKBP-type peptidyl-prolyl cis-trans isomerase (rotamase)

Reported regulatory sites for slyX: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.691 3475173-3475193 ttcag ACTCTTTTTGTTTAAATTAGT ttcga - 0 - 2.812 3475059-3475081 catcc ATATCTCCAGGATCGGGGCATCT caccc - 0 - 2.735 3475110-3475131 gaagg GTACTATAAAGCGTTGTCGAAC aaatc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back