smf_2

Information for smf_2, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3429629-3430102 - CDS smg EG11605 orf; hypothetical protein 3430074-3430382 - CDS smf_2 EG11604 orf; fragment 2 3430436-3431197 - CDS smf_1 EG11604 orf; fragment 1

Reported regulatory sites for smf_2: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.795 3430391-3430414 R agggc CTCACTGGTTAATAAAACAAGGTG cgatt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.518 3430417-3430435 R aatag GGAATCCGGGAAGCGAAGG gcctc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back