smp

Information for smp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4620670-4621686 - CDS lplA EG11796 lipoate-protein ligase A 4621714-4622358 - CDS smp EG10951 orf; hypothetical protein 4622464-4623432 + CDS serB EG10945 3-phosphoserine phosphatase

Reported regulatory sites for smp: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.846 4622377-4622398 R attgc TTCTGGCAACATTAAGTCTCAA atttt - 0 - 3.727 4622410-4622430 R gggaa AATAACGCATGAGGCTACCTT gtatc - 0 - 0.298 4622359-4622375 R tcaaa TTTTCAAAGGGTGGAAG atggc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back