smpA

Information for smpA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2749816-2751477 + CDS recN EG10831 protein used in recombination and DNA repair 2751815-2751967 + CDS smpA EG10952 small membrane protein A 2752029-2752337 - CDS b2618 EG13192 orf; hypothetical protein

Reported regulatory sites for smpA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.091 2751644-2751660 cgctg ACTGCTGCAGCAGCAGT actat - 0 - 6.934 2751776-2751794 gcatg ACGCAACAACAAGTTGCGT acgca - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.819 2751554-2751577 tgatg AAAGGTCTATTATCATCGGCATAT tacag - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back