smtA

Information for smtA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 971845-972624 - CDS ycbC EG12166 orf; hypothetical protein 972760-973545 + CDS smtA EG12167 S-adenosylmethionine-dependent methyltransferase 973542-974864 + CDS mukF EG12165 mukF protein (killing factor KICB)

Reported regulatory sites for smtA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.475 972628-972651 atcct TTCTGGTTCCTTTTTTAACCATAT agcaa - 0 - 3.475 972691-972714 gttca TTCTCGCCGTGGCTGTGACAAAAT agcgt - 0 - 2.961 972719-972735 tagcg TCTTTATCAGAAAACGT cttag - 0 - 2.638 972674-972690 gatat TACACCAGACGGGTTCA ttctc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back