sodB

Information for sodB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1732459-1733274 + CDS ydhO EG13949 putative lipoprotein 1733402-1733983 + CDS sodB EG10954 superoxide dismutase; iron 1734145-1735314 - CDS b1657 EG13950 putative transport protein

Reported regulatory sites for sodB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.045 1733349-1733372 tccat ACGCACAATAAGGCTATTGTACGT atgca - 0 - 1.017 1733328-1733344 acctt TTAATTTGCTACCCTAT ccata - 0 - 0.795 1733298-1733317 cggca ACAGGGTAAGTTCATCTTTT gtctc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back