sohB

Information for sohB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1326378-1327136 - CDS yciK EG11759 putative oxidoreductase 1327356-1328405 + CDS sohB EG10956 putative protease 1328441-1328692 - CDS yciN EG12868 orf; hypothetical protein

Reported regulatory sites for sohB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.927 1327187-1327207 atgac TTTGGGGCTTTATGCCTGAAA cagaa - 0 - 1.411 1327248-1327271 ccgca AAATGGATACTTTGTCATACTTTC gctgc - 0 - 0.958 1327330-1327347 ccaaa GCGTTGTTTAACCAAGGT gggga - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back