solA

Information for solA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1118530-1118670 - CDS yceO EG14334 orf; hypothetical protein 1118691-1119809 - CDS solA EG12669 sarcosine oxidase-like protein 1119924-1120178 - CDS yceP EG14335 orf; hypothetical protein

Reported regulatory sites for solA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.272 1119843-1119866 R tgggt TGTATATCTGCATTCAGTTAATTA ctctg - 0 - 0.250 1119901-1119923 R attaa CATGACATGACCATCCACCCAAA aggca - 0 - 0.250 1119819-1119841 R attac TCTGCTTAAACCATGAGAGCAGA gagaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back