soxR

Information for soxR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4274639-4274962 - CDS soxS EG10958 regulation of superoxide response regulon 4275048-4275512 + CDS soxR EG10957 redox-sensing activator of soxS 4276058-4277407 + CDS yjcD EG11939 orf; hypothetical protein

Reported regulatory sites for soxR: Genome coordinates Source Transcription factor Transcription factor annotation 4275018-4275042 PMID: 8306957 soxR redox-sensing activator of soxS

Species with an ortholog: PA ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 9.769 4275019-4275036 taatt CCTCAAGTTAACTTGAGG taaag soxR 18 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.670 4274995-4275017 cgtta ATTCATCTGTTGGGGAGTATAAT tcctc - 0 -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back