soxS

Information for soxS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4273050-4274636 + CDS yjcC EG11938 orf; hypothetical protein 4274639-4274962 - CDS soxS EG10958 regulation of superoxide response regulon 4275048-4275512 + CDS soxR EG10957 redox-sensing activator of soxS

Reported regulatory sites for soxS: Genome coordinates Source Transcription factor Transcription factor annotation 4275018-4275042 PMID: 8306957 soxR redox-sensing activator of soxS 4275041-4275075 DPInteract soxS regulation of superoxide response regulon

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 9.483 4275020-4275035 aattc CTCAAGTTAACTTGAG gtaaa soxR 16 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.256 4274995-4275017 R gagga ATTATACTCCCCAACAGATGAAT taacg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back