speB

Information for speB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3079806-3080690 + CDS yggG EG11291 orf; hypothetical protein 3080896-3081816 - CDS speB EG10960 agmatinase 3081954-3083930 - CDS speA EG10959 biosynthetic arginine decarboxylase

Reported regulatory sites for speB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.309 3081857-3081879 R ccctt CCTCGTCGGGCCTAACGACGCGG aaggg - 0 - 2.878 3081911-3081929 R cgctt AATTTAGCGGTGATAATCC gccac - 0 - 2.374 3081893-3081910 R aatcc GCCACAATTTATTGTGAC aaatc - 0 - -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back