speE

Information for speE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 134788-135582 - CDS speD EG10962 S-adenosylmethionine decarboxylase 135598-136464 - CDS speE EG10963 spermidine synthase = putrescine aminopropyltransferase 136570-137040 - CDS yacC EG11089 orf; hypothetical protein

Reported regulatory sites for speE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.622 136524-136543 R aatat TGACCGTGCATCCGCGGTCA atgtt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.840 136478-136501 R gcgcc CTTTTTTTACGGGTGTTAACAAAG gaggt - 0 - 4.473 136501-136521 R tcaat GTTAGCTATTATGTTGCGCCC ttttt - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back