speF

Information for speF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 716169-717488 - CDS potE EG10753 putrescine transport protein 717485-719683 - CDS speF EG10964 ornithine decarboxylase isozyme; inducible 720279-720956 - CDS kdpE EG10517 regulator of kdp operon (transcriptional effector)

Reported regulatory sites for speF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.387 719778-719801 R ttctg AAAAAAGCAATCTACCTGATTTAT ttatc - 0 - 1.849 720123-720141 R aaatt AAGATTGATCATTTTTTAT tgatc - 0 - 1.709 719974-719997 R ctcat ATTATGAAGTTTGCTCATCGCAAT agctt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back