spr

Information for spr, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2266838-2267587 + CDS b2174 EG14075 orf; hypothetical protein 2267999-2268565 + CDS spr EG14076 putative lipoprotein 2268746-2270302 + CDS rtn EG14077 orf; hypothetical protein

Reported regulatory sites for spr: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.611 2267766-2267781 tcact TTTTCTTATAAAAAAT catgt - 0 - 3.611 2267948-2267963 tggca TTTTTTTATAACGATA tttgt - 0 - 2.864 2267868-2267891 atata ATTTTGTGCGTTAGTCCACAGATT tggcc - 0 - 2.136 2267965-2267988 gatat TTGTCGTTAAGGACTTCAAGGGAA aacaa - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back