sprT

Information for sprT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3086303-3087697 + CDS galP EG12148 galactose-proton symport of transport system 3087774-3088271 + CDS sprT EG12122 orf; hypothetical protein 3088366-3089073 + CDS endA EG11336 DNA-specific endonuclease I

Reported regulatory sites for sprT: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.815 3087726-3087749 cggag GAAGCCACCTCTTGCAGTCATCTT ttctt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back