spy

Information for spy, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1822386-1823024 - CDS b1742 EG13994 orf; hypothetical protein 1823164-1823649 - CDS spy EG13490 periplasmic protein related to spheroblast formation 1823979-1824947 - CDS ydjS EG13995 orf; hypothetical protein

Reported regulatory sites for spy: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.248 1823852-1823872 R tatag TTCTTCATAATCTCTGCAAAA tcatc - 0 - 4.248 1823782-1823802 R ttttt TTCTCCATAATTGGCGCAAAA gtgtt - 0 - 1.518 1823755-1823775 R tgttt TTTACACTTTCATTGTTTTAC cgttg - 0 - 1.415 1823906-1823927 R taaat TAATACAGATTAATCCTGGTTA tttgc - 0 - 1.415 1823731-1823752 R taccg TTGCTCTGATTAATTGACGCTA aagtc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back