srlA

Information for srlA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2822514-2823599 - CDS mltB EG12699 membrane-bound lytic murein transglycosylase B 2823855-2824418 + CDS srlA EG10969 PTS system; glucitol/sorbitol-specific IIC component; one of two 2824415-2825374 + CDS srlE EG14373 PTS system; glucitol/sorbitol-specific IIB component and second of two IIC components

Reported regulatory sites for srlA: Genome coordinates Source Transcription factor Transcription factor annotation 2823762-2823783 DPInteract crp cyclic AMP receptor protein

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.999 2823745-2823765 aaatt AAAATATTTATCTTTCATTTT gcgat crp 4 - 4.999 2823772-2823792 cgatc AAAATAACACTTTTAAATCTT tcaat crp 12 - 3.399 2823615-2823638 tttaa CAGATTCAACCAGGGGCAAGTATG gtaaa - 0 - 1.839 2823654-2823669 acgcc CCGCACAAGGAAGCGG tagtc - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back