sseB

Information for sseB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2650355-2651359 + CDS sseA EG11600 putative thiosulfate sulfurtransferase 2652177-2652962 - CDS sseB EG11601 enhanced serine sensitivity 2653095-2654465 - CDS pepB EG12310 putative peptidase

Reported regulatory sites for sseB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.346 2653050-2653065 R acgcc TTATCCGGCCTACAAA ttctg - 0 REP183b (13) 4.346 2653006-2653021 R aatcc CTTGTAGGCCTGATAA gcgta - 0 REPv183a (13) 0.561 2653027-2653046 R aattc TGCAAATTCAACAAATTGCG aatcc - 0 - 0.326 2653068-2653084 R tatgc CGGATGCGGCGTAAACG cctta - 0 REP183b (17) 0.326 2652974-2652990 R tcagg CATTTGCGCCCCGAACG ttgaa - 0 REPv183a (1)

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back