stpA

Information for stpA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2795541-2796065 + CDS ygaP EG13288 orf; hypothetical protein 2796112-2796516 - CDS stpA EG11554 DNA-binding protein; H-NS-like protein; chaperone activity; RNA splicing? 2797185-2797634 + CDS b2670 EG13525 orf; hypothetical protein

Reported regulatory sites for stpA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.945 2796963-2796982 R ccgat ATGATTTATTTTTAATTAAA tcaat - 0 - 1.702 2796625-2796648 R gtttc AGAAAATAACAGCTGAAATAATCT cgcgc - 0 - 1.143 2796678-2796701 R atcta AATTACTCATCAAAATGGCTAATA tataa - 0 - 1.143 2796575-2796598 R taaat TTTGTGGAAATATAATAAGTGATC gctta - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back