surA

Information for surA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 52427-53416 - CDS pdxA EG10691 pyridoxine biosynthesis 53416-54702 - CDS surA EG10985 survival protein 54755-57109 - CDS imp EG11569 organic solvent tolerance

Reported regulatory sites for surA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.402 54735-54757 R ctttg TGATTTGTTGATTTACCACGTAA tccgc - 0 - 3.402 54707-54729 R tccgc AGTGCGGTTAATTGAAATGGAAA aagta - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back