syd

Information for syd, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2921806-2922135 - CDS b2792 EG13172 orf; hypothetical protein 2922757-2923302 - CDS syd EG12959 interacts with secY 2923370-2924218 + CDS yqcD EG13173 orf; hypothetical protein

Reported regulatory sites for syd: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.229 2923327-2923350 R aacca GATAAACTAAACGACAAGTGTATC tggtt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.699 2923353-2923369 R gacat GTTTCACCGTCATAAAC cagat - 0 - 0.937 2923308-2923324 R atctg GTTTAAGTGAAGAGAGA aatta - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back