tag

Information for tag, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3709865-3710569 - CDS yhjY EG12269 putative lipase 3710721-3711284 + CDS tag EG10986 3-methyl-adenine DNA glycosylase I; constitutive 3711281-3711721 + CDS yiaC EG12270 orf; hypothetical protein

Reported regulatory sites for tag: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.569 3710570-3710592 aacac GACTCCAGGGAAGAGCCGAATTC ggcaa - 0 - 1.328 3710593-3710613 aattc GGCAATATTATTGTCATTGTA tgaag - 0 - 1.328 3710634-3710654 atagt AGCCCTGTATTAAATATTGAC ttttt - 0 - 1.314 3710650-3710673 aaata TTGACTTTTTCACCGATGCGTCAA gaaaa - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back